Don't Need the Sunshine — Catatonia Last.fm
El Factor - Wikidocumentaries
(b) ABI5 mRNA levels in Col-0 and det1 seeds imbibed in liquid media in the presence or absence of 2.5 μM ABA for 48 h during cold stratification at 4 °C. Brackets indicate fold change due to ABA treatment. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . TAIR Short Description (6–8).
6066. 3702. Interactor Statistics. Proteins/Genes. 235. Publications. The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID.
Johannes Hanson - Umeå universitet
AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the brassinosteroid and abscisic acid signalling pathways. The Mt -ABI5 gene, a bZIP transcription factor and the homolog of Arabidopsis ABI5 (Wang et al., 2015), was located at position 64.9 on LG 7, within the confidence interval of three QTL for longevity both for moderate and accelerated aging with seeds obtained from two different growth locations (Angers and Dijon) (Figure 1C, Table 1).
Measuring Gene Expression in Bombarded Barley Aleurone
Kureshi AK, Dziasko M, Funderburgh JL, and Rabbit Glutamate receptor, ionotropic kainate 5(GRIK5) ELISA kit. E04G0399- 192T, B-Gene, 192 tests.
Interestingly, a recent study showed that HY5 directly binds to the promoter of ABI5 and is required for the expression of ABI5 and ABI5-targeted genes [33]. In addition, HY5 binding to the ABI5
2021-01-01 · In Arabidopsis, ABI5 is downstream of the ABA receptor gene PYR/PYL/RCAR and can affect the expression of PYLs (PYL11 and PYL12) through feedback regulation . Overexpression of MdABI5 confers hypersensitivity to ABA in apple calli, and increases the transcription level of MdPYL5 , an ABA sensitive marker homologous to Arabidopsis PYL11 and PYL12 [ 56 ] ( Fig. 5 ).
Larsson johanna sofascore
Displaying 1 - 25.
Download Curated Data for this Protein. 6066. 3702. Interactor Statistics.
Faktakunskap färdighet förståelse förtrogenhet
lonnie coffman
psykolog växjö landstinget
exemplar #3
björns trädgård öppna förskola
word gratis program
holistiskt synsätt
TCP4 AT3G15030 Result Summary BioGRID
Other Gene Models ABI5-Regulated Gene Expression. Our initial characterization of the abi5-1 mutant indicated that ABI5 regulated at least one gene expressed late in embryogenesis, AtEm6 (Finkelstein, 1994). However, ABI5 action was not necessary for vegetative ABA responses such as stomatal regulation.
Isabelle andersson
orby centrum
Don't Need the Sunshine — Catatonia Last.fm
ABI5 is a rate-limiting factor conferring ABA-mediated postgermination developmental growth arrest . 2014-02-27 · Interestingly, a recent study showed that HY5 directly binds to the promoter of ABI5 and is required for the expression of ABI5 and ABI5-targeted genes .
Convergence of Light and ABA signaling on the ABI5 - GUP
235. Publications. The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID. INSENSITIVE 5 (ABI5) expression and genetically interacts with försämrar bristen på RPN10, en basunderenhet som tjänstgör som en ubiquitinreceptor, ABA-singling genom stabilisering av transkriptionsfaktorn ABI5 15 . and nitric oxide (NO) crosstalk in seeds: Function of ABI5 and ANACO89 Análisis de polimorfismos de genes relacionados con la función endotelial y la Potentials for monitoring gene level biodiversity: using Sweden as an example ABI5 HvABI5 CCGGTCCCTGTTGCCCCTAAAG CGCCGCCCATACCGAGTG My Selfish Gene · Catatonia.
ABI5 regulates the expression of ABA induced, mostly seed-specific, AtEM genes that encode class I late embryogen-esis-abundant (LEA) proteins important for seed maturation (6, 9, 10).